1. INTRODUCTION
Excessive storage of lipid in hepatocytes is the main characteristic of nonalcoholic fatty liver disease (NAFLD) [1] and is related to an increased risk of metabolic diseases such as obesity and dyslipidaemia [2]. The high level of free fatty acids (FFAs) in the blood is generally found in both obesity [3] and NAFLD [4]. Elevated FFA levels lead to increased uptake and storage of lipids in the liver and muscles [5]. This is accompanied by an increase in hepatic de novo lipogenesis and triglyceride synthesis mediated by sterol regulatory element-binding protein 1c (SREBP1c) [6]. Activation of transcriptional factor SREBP1c stimulates main enzymes such as acetyl-CoA carboxylase (ACC) and fatty acid synthase (FAS), which contribute to excessive hepatic triglyceride accumulation in patients with NAFLD [7]. Peroxisome proliferator-activated receptor α (PPARα) is an important transcriptional regulator involved in hepatic lipid homeostasis, including fatty acid (FA) activation and transport to the mitochondria, β-oxidation, and lipogenesis [8]. Additionally, impaired β-oxidation may induce lipid accumulation. However, the activation of β-oxidation in the peroxisomes and microsomes is a possible pathway for regulating the overproduction of fatty acids (FAs) in hepatocytes [9]. Cytochrome P450 2E1 (CYP2E1) is highly expressed in response to the pathological processes of metabolic diseases [9]. CYP2E1 induction is an alternative response that prevents FA overload via β-oxidation [10], and elevated CYP2E1 activity has been reported in obesity and NAFLD [11]. Furthermore, the major FAs related to de novo lipogenesis are palmitic acid (PA) and stearic acid, which are linked with the risk of type 2 diabetes and cardiovascular diseases [12]. It has been shown that PA can induce lipotoxicity in various cell lines [13–15], and HepG2 cells are also used to create the NAFLD model through PA induction [13,14,16,17].
Bouea macrophylla Griffith (BM), commonly known as plum mango, is a tropical Asian plant known as Maprang in Thailand [18]. This plant belongs to the mango family of Anacardiaceae. It has been reported that many parts of the BM, including the fruit, leaf, stem, and seed, have several pharmacological properties, such as antioxidant [19–21], anticancer [22–24], and antihyperglycaemic [25,26] activities. Moreover, the root extracts of some species in the Anacardiaceae family, including Mangifera indica (mango) and Anacardium occidentale (cashew), contain phenolic and flavonoid components with pharmacological effects such as antihyperglycaemia and antioxidation [27,28]. BM is also a member of the Anacardiaceae family; however, pharmacological information on its root part is still lacking, especially regarding its potential role in regulating obesity, which is one of the major public health threats [29]. Currently, medicinal plants are popular alternatives for disease treatment. Therefore, the present study was undertaken to examine the effect of BM root ethanolic extract (BME) on regulating lipid homeostasis in PA-induced lipid accumulation in HepG2 cells, which is related to various chronic diseases such as obesity and NAFLD.
2. MATERIALS AND METHODS
2.1. Chemicals
The following chemicals were purchased: standard bioactive compounds, including caffeic acid, chlorogenic acid, coumaric acid, ellagic acid, ferulic acid, gallic acid, hesperidin, quercetin, rosmarinic acid, rutin, and vanillin (Sigma-Aldrich, USA). Chemicals for cell culture and gene expression analysis were obtained as follows: sodium palmitate, bovine serum albumin (BSA) (FA-free), dimethyl sulfoxide (DMSO), thiazolyl blue tetrazolium bromide (MTT), and Oil Red O (ORO) dye (Sigma-Aldrich, USA), cDNA synthesis kit (Bio-Rad, USA), penicillin-streptomycin (Gibco, USA), Dulbecco’s modified Eagle’s medium (DMEM), and fetal bovine serum (Cytiva HyClone, USA).
2.2. Plant extraction
BM roots were collected from the Fruit Garden, Mueang District, Chanthaburi Province, Thailand. Voucher specimen, UBU-BM-1 (B. macrophylla Griffith, Thaweesak Juengwatanatrakul) was deposited in the Faculty of Pharmaceutical Sciences, Ubon Ratchathani University. The dried plant roots (30 g) were extracted with 300 ml of absolute ethanol for 3 days using the maceration technique, and the solvent was then evaporated to obtain the dry extract. The yield of dry powdered BME was 10%.
2.3. Phytochemical screening tests
Phytochemical screening of BME was performed to identify the main classes of compounds (alkaloids, amines, coumarins, flavonoids, and phenolics) present in the extracts, following standard protocols [30].
2.4. Total phenolic content (TPC) test
TPC was determined using the Folin-Ciocalteu assay, as described by Zahoor et al. [31] with slight modifications. BME (1 mg) was dissolved in methanol (1 ml). The prepared samples (1 ml) were then incubated with 10% Folin-Ciocalteu reagent (1 ml) and 7.5% sodium carbonate solution (2 ml) in the dark. Absorbance was measured after 30 minutes at 765 nm. TPC was calculated as mg gallic acid equivalents (mg GAE)/g of dry extract.
2.5. Total flavonoid content (TFC) test
BME (1 mg) was dissolved in methanol (1 ml) and diluted with distilled water (diluted 10-fold). The diluted samples were incubated with 5% sodium nitrite solution (2 ml) for 5 minutes and then 10% aluminium chloride solution (2 ml) was added. The mixture was vortexed and mixed with 1 M sodium hydroxide (2 ml) and after 10 minutes the absorbance was measured immediately at 415 nm. TFC was calculated as mg quercetin equivalents (mg QE)/g of dry extract.
2.6. High-performance liquid chromatography (HPLC) analysis
HPLC analysis was performed in triplicate by using a Dionex UltiMate™ 3000 HPLC system and C18 column (5 μm, 250 mm × 4.6 mm) (ACE, UK), following the protocol by Nanna et al. [32]. The mobile phase consisting of 0.1% acetic acid (solvent A) and acetonitrile (solvent B). The gradient set at 90:10 (A: B) for 5 minutes, shifted to 72:28 for 15 minutes, then to 50:50 for 10 minutes, followed by 35:65 for 10 minutes, 25:75 for 5 minutes, and finally to 0:100 for 5 minutes. The injection volume was 10 μl at a flow rate of 0.8 ml/minute and 25°C as the column temperature. The wavelength of detection was established at 254 nm. BME ingredients were identified by comparing their retention times and UV-VIS detector with those of the following standards (caffeic acid, chlorogenic acid, coumaric acid, ellagic acid, ferulic acid, gallic acid, hesperidin, quercetin, rosmarinic acid, rutin, and vanillin). Semi-quantitative data were analysed based on the area under the peak relative to the content of each component in the extract.
2.7. Cell culture and experimental design
All study protocol was reviewed and approved by the Thammasat University Institutional Biosafety Committee (TU-IBC 036/2566). HepG2 cells (Lot#70057473) were obtained from the American Type Culture Collection (Virginia, USA). An in vitro model of NAFLD was established by inducing lipid overload in hepatocytes through 24 hours incubation with a high concentration of PA [33]. The PA-BSA conjugate was prepared as previously described [34]. Briefly, a stock solution of PA (50 mM) was dissolved in 0.1 M NaOH, then diluted in DMEM containing 1% BSA (FA-free) and incubated for 1 hour to allow conjugation. The solution was filtered through a 0.22 μm filter and stored at −20°C until use. The PA stock was diluted with DMEM to a final concentration of 250 μM. HepG2 cells were divided into three groups: a control group (untreated), a PA-treated group, and a BME-treated group. Lipid overload was induced using 250 μM PA. After 24 hours of PA incubation, the various concentrations of BME (1, 5, and 10 μg/ml) were added to the BME-treated groups for 48 hours. At the end of the experiment, cells were collected for lipid accumulation and lipogenic gene expression analyses. Six independent experiments were performed in duplicate.
2.8. Cell viability assay
HepG2 cells were seeded in a 96-well plate at a density of 1 × 104 cells/ml and cultured for 24 hours. Lipid overload was induced using PA, followed by treatment with various concentrations of BME (0, 1, 5, 10, 50, 100, and 200 μg/ml) for 48 hours. Then, 0.5 mg/ml MTT solution (100 μl) was added to each well and incubated at 37°C for 4 hours. The MTT solution was discarded, and 100 μl of DMSO was added to dissolve formazan crystals. Absorbance was measured at 545 nm to determine cell viability.
2.9. ORO staining
HepG2 cells were seeded at a density of 1 × 104 cells/ml in the culture chamber slides and 96-well plates. After 48 hours BME treatment, the medium was discarded and then rinsed with phosphate-buffered saline. Cells were fixed in 10% formalin and washed with isopropanol. Then, cells were stained with 0.6% ORO solution for 1 hour. A picture of stained cells was taken by a Primovert microscope (Carl Zeiss, USA) at ×40 magnification. Lipid accumulation in the culture plates was quantified by extracting the stain with isopropanol and measuring absorbance at 500 nm.
2.10. Quantitative reverse transcription polymerase chain reaction
Total RNA was extracted according to the manufacturer’s instructions (Vivantis, Kuala Lumpur, Malaysia), and RNA quantification was measured using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific). cDNA was produced using the iScript cDNA synthesis kit. Reverse transcription polymerase chain reactionwas performed using LightCycler 480 SYBR Green I Master Mix (Roche Diagnostics), with three technical replicates for each analysis. Primer sequences used in this study are listed in Table 1. The mRNA levels of all genes were normalised using β-actin as an internal control, and relative quantitation was performed using the 2−ΔΔCt method.
Table 1. Primers and their sequences.
| Primers | Primer sequences (5’- 3’) |
|---|---|
| SREBP1c Forward | CCACTTCATCAAGGCAGACTCG |
| SREBP1c Reverse | CAAGATGGTTCCGCCACTCAC |
| ACC Forward | CTTGGCCTTGCACATAAGGTCC |
| ACC Reverse | CCACCTACGGATAGACCGCA |
| FAS Forward | ATAGTGTGGAAGACGCTGGC |
| FAS Reverse | CTGGTACACCTTCCCACTCAC |
| PPARα Forward | CAATGCACTGGAACTGGATGA |
| PPARα Reverse | GTTGCTCTGCAGGTGGAGTCT |
| CYP2E1 Forward | GCACAGGGACAGGGGAATC |
| CYP2E1 Reverse | GAGGAAGGTGGGGTCGAAAG |
| β-actin Forward | GATTCCTATGTGGGCGACGA |
| β-actin Reverse | AGGTCTCAAACATGATCTGGGT |
2.11. Statistical analysis
All experiments were performed in duplicate and repeated six times independently. Statistical analyses were performed using SPSS software (version 26.0). Results were expressed as mean ± SEM. Differences among groups were analysed using one-way ANOVA, followed by Tukey’s post hoc test. A p-value < 0.05 was considered statistically significant.
3. RESULTS
3.1. Phytochemical contents
The compound expression of alkaloids, amines, coumarins, flavonoids, and phenolic groups in BME was determined. The phytochemical content in the extracts was visually observed based on the color present. Results obtained are shown in Table 2, amines, flavonoids, and phenolics were found in BME, while alkaloids and coumarins were not detected. The TPC and the TFC are shown in Table 3. The results indicated that phenolic compound (616.18 ± 8.67 mg GAE/g) was the most abundant in the extract, followed by TFC (142.65 ± 3.40 mg QE/g).
Table 2. Phytochemical screening of BME.
| Phytochemical | BME |
|---|---|
| 1. Alkaloids | − |
| 2. Amines | + (purple) |
| 3. Coumarins | − |
| 4. Flavonoids | + (orange) |
| 5. Phenolics | + (green) |
Data are expressed as (+) for the presence and (−) for the absence of groups of compounds.
Table 3. Total phenolic content and total flavonoid content of BME.
| Test | Content |
|---|---|
| 1. Total phenolic content | 616.18 ± 8.67 mg GAE/g |
| 2. Total flavonoid content | 142.65 ± 3.40 mg QE/g |
Data are expressed as mean ± SEM (n = 3).
mg GAE = mg gallic acid equivalents; mg QE = mg quercetin equivalents.
3.2. HPLC analysis
HPLC was employed for plant fingerprinting, and only gallic acid was quantified. The HPLC chromatograms of BME and gallic acid were shown in Figure 1A and B, respectively. BME showed that the gallic acid was predominantly present at 83.91 ± 0.01 mg/g of dry extract. No other standards were detected in the root extracts (Table 4).
 | Figure 1. HPLC Chromatogram of BME (A) and gallic acid (B). Data are expressed as mean ± SEM (n = 3). [Click here to view] |
Table 4. Bioactive compound content of BME.
| Bioactive compound | Content |
|---|---|
| 1. Gallic acid | 83.91 ± 0.01 mg/g dry extract |
| 2. Caffeic acid | None |
| 3. Coumaric acid | None |
| 4. Ferulic acid | None |
| 5. Rosmarinic acid | None |
| 6. Chlorogenic acid | None |
| 7. Ellagic acid | None |
| 8. Vanillin | None |
| 9. Rutin | None |
| 10. Quercetin | None |
| 11. Hesperidin | None |
Data are expressed as mean ± SEM (n = 3).
3.3. Cell viability of BME
After 48 hours incubation with various BME concentrations, concentrations from 50 to 200 μg/ml of BME showed significant cytotoxicity (Fig. 2A). Thus, the present study selected BME concentrations of 1–10 μg/ml for further examination of regulating impaired lipid homeostasis in HepG2 cells.
 | Figure 2. Effects of BME on lipid accumulation in PA-induced HepG2 cells. (A) Viability of HepG2 cells using MTT assay. (B) Lipid accumulation was extracted by isopropanol, and the quantitative content was measured at 500 nm. (C) Oil Red O-stained image of HepG2 cells observed under a microscope (400×). Data are expressed as mean ± SEM (n = 6). *p < 0.05 versus the control group (untreated cells). #p < 0.05 versus the PA-treated group. [Click here to view] |
3.4. Hepatic lipid accumulation of BME
As shown in Figure 2B, the quantity of lipid droplets was significantly increased in the PA-treated group compared to that in the control group, whereas the BME (5–10 μg/ml) showed significantly decreased lipid accumulation. Moreover, the widespread lipid droplets were obviously revealed in the PA-treated group. Interestingly, the BME-treated groups could decrease lipid droplets in comparison to the PA-treated group (Fig. 2C).
3.5. Lipid homeostasis gene expression of BME
The PA-treated group showed significantly increased lipogenic gene expression of SREBP1c, ACC, and FAS compared to the control group (Fig. 3A–C). However, the BME-treated groups at 1–10 μg/ml significantly suppressed these genes in comparison to the PA-treated group. Furthermore, compared to the PA-treated group, the concentrations of BME at 5 or 10 μg/ml significantly increased the expression of the FA oxidation gene, PPARα (Fig. 3D). Moreover, BME (5–10 μg/ml) significantly suppressed expression of the CYP2E1 gene (Fig. 3E).
 | Figure 3. Effects of BME on gene expression of lipid homeostasis in PA-induced HepG2 cells. (A) SREBPIC, (B) ACC, (C) FAS, (D) PPARα, and (E) CYP2E1, β-actin was used as an internal control. Data are expressed as mean ± SEM (n = 6). *p < 0.05 versus the control group (untreated cells). #p < 0.05 versus the PA-treated group. [Click here to view] |